pIVEX2.3-Theo-3c-EGFP
(Plasmid
#217526)
-
PurposeTheo-3c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.
-
Depositing Lab
-
Depositing OrganizationTokyo Institute of Technology (Inactive)
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 217526-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 217526-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIVEX2.3
- Total vector size (bp) 4236
-
Vector typeIn vitro transcription-translation
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTheo-3c riboswitch-regulated EGFP
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCGTCCGGCGTAGAGGATCGAGA
- 3′ sequencing primer AGGGGTTATGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 217526-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 217526-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIVEX2.3-Theo-3c-EGFP was a gift from Keisuke Fukunaga (Addgene plasmid # 217526 ; http://n2t.net/addgene:217526 ; RRID:Addgene_217526) -
For your References section:
Switchable and orthogonal gene expression control inside artificial cells by synthetic riboswitches. Ishii Y, Fukunaga K, Cooney A, Yokobayashi Y, Matsuura T. Chem Commun (Camb). 2024 Jun 4;60(46):5972-5975. doi: 10.1039/d4cc00965g. 10.1039/d4cc00965g PubMed 38767578