mouse b6 full length
(Plasmid
#217816)
-
PurposeFull length mouse integrin b6 expression
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 217816-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 217816-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepD2529 CAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITGB6
-
Alt nameIntegrin beta 6
-
SpeciesM. musculus (mouse)
-
Entrez GeneItgb6 (a.k.a. 2210409C20Rik, 4831415H04Rik)
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer CATGTGCACCTTGAAGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.26.577394 for bioRxiv preprint.
DNA (Catalog # 217816-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 217816-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mouse b6 full length was a gift from Timothy Springer (Addgene plasmid # 217816 ; http://n2t.net/addgene:217816 ; RRID:Addgene_217816) -
For your References section:
Synthetic integrin antibodies discovered by yeast display reveal alphaV subunit pairing preferences with beta subunits. Hao Y, Yan J, Fraser C, Jiang A, Anuganti M, Zhang R, Lloyd K, Jardine J, Coppola J, Meijers R, Li J, Springer TA. MAbs. 2024 Jan-Dec;16(1):2365891. doi: 10.1080/19420862.2024.2365891. Epub 2024 Jun 18. 10.1080/19420862.2024.2365891 PubMed 38889315