Skip to main content

pAGT9569
(Plasmid #219431)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219431 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pICH47742
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 4356
  • Total vector size (bp) 14110
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology ; MoClo compatible Level 1 module (position 2)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LB_AtRPS5a:PapE-4xLF2-NLS-SpCas9i-NLS:tNOS_RB (Position 2)
  • Alt name
    PapE-4LF2-Cas9
  • Species
    A. thaliana (mustard weed), Synthetic; Papiine 189 alpha Herpes Virus 2, Streptococcus pyogenes SF370, Agrobacterium tumefaciencs
  • Insert Size (bp)
    10096
  • Tag / Fusion Protein
    • PapE-4LF2 (N terminal on insert)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer TGTTGGCTGGCTGGTGGCAGG
  • 3′ sequencing primer CTCTTTTCTCTTAGGTTTACCCGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The AtRPS5a promoter Module pJOG603 was generated by Johannes Stuttmann

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGT9569 was a gift from Tom Schreiber (Addgene plasmid # 219431 ; http://n2t.net/addgene:219431 ; RRID:Addgene_219431)
  • For your References section:

    Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR/Cas endonucleases. Schreiber T, Prange A, Schafer P, Iwen T, Grutzner R, Marillonnet S, Lepage A, Javelle M, Paul W, Tissier A. Mol Plant. 2024 Mar 22:S1674-2052(24)00086-8. doi: 10.1016/j.molp.2024.03.013. 10.1016/j.molp.2024.03.013 PubMed 38520090