pafG-CBE-3T
(Plasmid
#220374)
-
Purposefor hA3A-nCas9 and gRNA expression in Aspergillus flavus
-
Depositing Lab
-
Depositing OrganizationRice University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 220374-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 220374-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonehAMA1-pyrG-AmpR-ori-2 micron-URA3
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namehA3A-nCas9
- Promoter Ptef1
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer catctcctgctaacttctctgc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametRNA and gRNA scaffold
- Promoter tRNA
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer GATGAGCCGCTCTTGCATCTTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 220374-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 220374-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pafG-CBE-3T was a gift from Xue Gao (Addgene plasmid # 220374 ; http://n2t.net/addgene:220374 ; RRID:Addgene_220374) -
For your References section:
Multiplex Base-Editing Enables Combinatorial Epigenetic Regulation for Genome Mining of Fungal Natural Products. Zhao F, Sun C, Liu Z, Cabrera A, Escobar M, Huang S, Yuan Q, Nie Q, Luo KL, Lin A, Vanegas JA, Zhu T, Hilton IB, Gao X. J Am Chem Soc. 2023 Jan 11;145(1):413-421. doi: 10.1021/jacs.2c10211. Epub 2022 Dec 21. 10.1021/jacs.2c10211 PubMed 36542862
Map uploaded by the depositor.
