-
PurposeCRISPRcharm Kv1 expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 220838-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 220838-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCAG expression plasmid
- Backbone size w/o insert (bp) 4830
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPRcharm Kv1
-
SpeciesH. sapiens (human); Apodemus sylvaticus
-
Insert Size (bp)6231
-
MutationN/A
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-TagBFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGCTGTCTCATCATTTTGGCAAAGAATTCTGCAG
- 3′ sequencing primer ccaacacactattgcaatgaaaa
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 220838-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 220838-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENN239_CRISPRcharm_Kv1 was a gift from Jonathan Weissman (Addgene plasmid # 220838 ; http://n2t.net/addgene:220838 ; RRID:Addgene_220838) -
For your References section:
Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic editor. Neumann EN, Bertozzi TM, Wu E, Serack F, Harvey JW, Brauer PP, Pirtle CP, Coffey A, Howard M, Kamath N, Lenz K, Guzman K, Raymond MH, Khalil AS, Deverman BE, Minikel EV, Vallabh SM, Weissman JS. Science. 2024 Jun 28;384(6703):ado7082. doi: 10.1126/science.ado7082. Epub 2024 Jun 28. 10.1126/science.ado7082 PubMed 38935715
