CRISPRoff-v2.1
(Plasmid #167981)

• Purpose: Expresses CRISPRoff-v2.1 (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) downstream of the CAG promoter
• Depositing Lab: Luke Gilbert
• Depositing Organization: University of California, San Francisco (UCSF)
  Located in United States of America
• Publication: Nuñez et al Cell. 2021 Apr 7. pii: S0092-8674(21)00353-6. doi: 10.1016/j.cell.2021.03.025.
• Citations: 20 Articles

Backbone

• Vector backbone: CAG expression plasmid
• Backbone size w/o insert (bp): 4836
• Total vector size (bp): 11874
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRISPRoff-v2.1 (DNMT3A-DNMT3L-dCas9-BFP-KRAB)
• Species: H. sapiens (human)
• Insert Size (bp): 7038
• Promoter: CAG
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • tagBFP (C terminal on insert)
  • 2xNLS (C terminal on insert)
  • DNMT3A-DNMT3L (N terminal on insert)
  • KRAB (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcaaagaattctgcagtcg
• 3′ sequencing primer: ccaccaccttctgataggc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The dCas9 and KRAB sequences were obtained from a previous CRISPRi construct (Gilbert et al., 2013). The DNMT3A and DNMT3L sequences, including the D3A-D3L fusion, originated from Stepper et al. 2017. XTEN linker sequences were previously published (Schellenberger et al., 2009).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 167981-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 167981-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.