Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #167981)


Item Catalog # Description Quantity Price (USD)
Plasmid 167981 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    CAG expression plasmid
  • Backbone size w/o insert (bp) 4836
  • Total vector size (bp) 11874
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    CRISPRoff-v2.1 (DNMT3A-DNMT3L-dCas9-BFP-KRAB)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter CAG
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • tagBFP (C terminal on insert)
    • 2xNLS (C terminal on insert)
    • DNMT3A-DNMT3L (N terminal on insert)
    • KRAB (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcaaagaattctgcagtcg
  • 3′ sequencing primer ccaccaccttctgataggc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The dCas9 and KRAB sequences were obtained from a previous CRISPRi construct (Gilbert et al., 2013). The DNMT3A and DNMT3L sequences, including the D3A-D3L fusion, originated from Stepper et al. 2017. XTEN linker sequences were previously published (Schellenberger et al., 2009).
  • Article Citing this Plasmid

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPRoff-v2.1 was a gift from Luke Gilbert (Addgene plasmid # 167981 ; ; RRID:Addgene_167981)
  • For your References section:

    Genome-wide programmable transcriptional memory by CRISPR-based epigenome editing. Nunez JK, Chen J, Pommier GC, Cogan JZ, Replogle JM, Adriaens C, Ramadoss GN, Shi Q, Hung KL, Samelson AJ, Pogson AN, Kim JYS, Chung A, Leonetti MD, Chang HY, Kampmann M, Bernstein BE, Hovestadt V, Gilbert LA, Weissman JS. Cell. 2021 Apr 7. pii: S0092-8674(21)00353-6. doi: 10.1016/j.cell.2021.03.025. 10.1016/j.cell.2021.03.025 PubMed 33838111