Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLX303-ZIM3-KRAB-dCas9
(Plasmid #154472)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154472 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLX303
  • Backbone manufacturer
    David Root
  • Total vector size (bp) 12279
  • Modifications to backbone
    dCas9 construct after Gateway recombination sites (C-terminal to the insert)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow at 30 degrees to avoid recombination
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZIM3
  • Species
    Synthetic
  • Mutation
    Includes ZIM3 aa 1-100
  • Entrez Gene
    ZIM3 (a.k.a. ZNF264, ZNF657)
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX303-ZIM3-KRAB-dCas9 was a gift from Mikko Taipale (Addgene plasmid # 154472 ; http://n2t.net/addgene:154472 ; RRID:Addgene_154472)
  • For your References section:

    An efficient KRAB domain for CRISPRi applications in human cells. Alerasool , N., Segal, D., Lee, H., & Taipale, M. Nat Methods (2020) 10.1038/s41592-020-0966-x