-
PurposeExpresses ABI1 fused to the N terminus of dCas9
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLX303
-
Backbone manufacturerDavid Root lab; Addgene plasmid #25897
- Total vector size (bp) 12879
-
Modifications to backboneAdded dCas9 to the 3' end of the Gateway cloning cassette
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30 degrees to avoid recombination
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABI1
-
SpeciesA. thaliana (mustard weed)
-
MutationIncludes ABI1 aa 126-423, D143A
-
Entrez GeneABI1 (a.k.a. AT4G26080, ABA INSENSITIVE 1, AtABI1, F20B18.190, F20B18_190, PROTEIN PHOSPHATASE 2C ABI1)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX303-ABI1-dCas9 was a gift from Mikko Taipale (Addgene plasmid # 154474 ; http://n2t.net/addgene:154474 ; RRID:Addgene_154474) -
For your References section:
An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655