TETv4
(Plasmid #167983)

• Purpose: Expresses TETv4 (TET1CD-XTEN80-dCas9-3xNLS-P2A-BFP) downstream of the CAG promoter
• Depositing Lab: Luke Gilbert
• Publication: Nunez et al Cell. 2021 Apr 7. pii: S0092-8674(21)00353-6. doi: 10.1016/j.cell.2021.03.025.

Backbone

• Vector backbone: CAG expression plasmid
• Backbone size w/o insert (bp): 5574
• Total vector size (bp): 11874
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TETv4 (TET1CD-XTEN80-dCas9)
• Species: H. sapiens (human)
• Insert Size (bp): 6581
• Promoter: CAG
• Tags / Fusion Proteins:
  • TET1 catalytic domain (N terminal on insert)
  • 3xNLS (C terminal on insert)
  • tagBFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcaaagaattctgcagtcg
• 3′ sequencing primer: ccaccaccttctgataggc

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence
• Addgene Notes:
  • Addgene Diagnostics Digest
• A portion of this plasmid was derived from a plasmid made by: The dCas9 sequence was obtained from a previous CRISPRi construct (Gilbert et al., 2013). The TET1CD sequence was obtained from Fuw-dCas9-Tet1CD (Addgene #84475). XTEN linker sequences were previously published (Schellenberger et al., 2009).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry