Src(WT)-SsrA(Y7I)-mCer3
(Plasmid
#220998)
-
PurposeThis is microTag (Y7I mutation in SsrA)-Src with mCerulean3 at C-terminal
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 220998-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 220998-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSrc, SsrA, mCerulean3
-
SpeciesM. musculus (mouse)
-
MutationY7I in SsrA
-
Entrez GeneSrc (a.k.a. pp60c-src)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 220998-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 220998-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Src(WT)-SsrA(Y7I)-mCer3 was a gift from Klaus Hahn (Addgene plasmid # 220998 ; http://n2t.net/addgene:220998 ; RRID:Addgene_220998) -
For your References section:
Biosensors based on peptide exposure show single molecule conformations in live cells. Liu B, Stone OJ, Pablo M, Herron JC, Nogueira AT, Dagliyan O, Grimm JB, Lavis LD, Elston TC, Hahn KM. Cell. 2021 Oct 28;184(22):5670-5685.e23. doi: 10.1016/j.cell.2021.09.026. Epub 2021 Oct 11. 10.1016/j.cell.2021.09.026 PubMed 34637702