Skip to main content

pMH4-SYN-EGFP-ER
(Plasmid #22285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22285 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 22285-D50 50 μg of DNA in Tris buffer $495
DNA 22285-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMH4
  • Backbone size w/o insert (bp) 6959
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a or JM 109 high efficiency
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP-ER
  • Alt name
    EGFP(A206K)mut-ER
  • Species
    mixture
  • Insert Size (bp)
    863
  • Mutation
    EGFP alanine 206 changed to Lysin
  • Tag / Fusion Protein
    • EGFP-ER

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

EGFP(A206K)= 925-1707
Calreticulin sgnalseq.=862-912
KDEL coding seq.=1714-1725

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH4-SYN-EGFP-ER was a gift from Thomas Oertner (Addgene plasmid # 22285 ; http://n2t.net/addgene:22285 ; RRID:Addgene_22285)
  • For your References section:

    Differential distribution of endoplasmic reticulum controls metabotropic signaling and plasticity at hippocampal synapses. Holbro N, Grunditz A, Oertner TG. Proc Natl Acad Sci U S A. 2009 Sep 1;106(35):15055-60. doi: 10.1073/pnas.0905110106. Epub 2009 Aug 18. 10.1073/pnas.0905110106 PubMed 19706463