pEN243-EN1953
(Plasmid
#224546)
-
PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 224546-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 224546-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX459
-
Backbone manufacturerAddgene #62988
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl
-
gRNA/shRNA sequenceCCAGAACTTCAGGATGAATG
-
SpeciesM. musculus (mouse)
-
Entrez GeneNipbl (a.k.a. Idn3)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 224546-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 224546-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN243-EN1953 was a gift from Elphege Nora (Addgene plasmid # 224546 ; http://n2t.net/addgene:224546 ; RRID:Addgene_224546) -
For your References section:
Synergy between regulatory elements can render cohesin dispensable for distal enhancer function. Hansen KL, Adachi AS, Braccioli L, Kadvani S, Boileau RM, Martinovic M, Pokorny B, Shah R, Anderson EC, Zhang K, Carel I, Bonitto K, Blelloch R, Fudenberg G, de Wit E, Nora EP. Science. 2025 Nov 27:eadt4221. doi: 10.1126/science.adt4221. 10.1126/science.adt4221 PubMed 41308125