Skip to main content

pEN243-EN1953
(Plasmid #224546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224546 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 224546-D50 50 μg of DNA in Tris buffer $495
DNA 224546-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX459
  • Backbone manufacturer
    Addgene #62988
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl
  • gRNA/shRNA sequence
    CCAGAACTTCAGGATGAATG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nipbl (a.k.a. Idn3)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN243-EN1953 was a gift from Elphege Nora (Addgene plasmid # 224546 ; http://n2t.net/addgene:224546 ; RRID:Addgene_224546)
  • For your References section:

    Synergy between regulatory elements can render cohesin dispensable for distal enhancer function. Hansen KL, Adachi AS, Braccioli L, Kadvani S, Boileau RM, Martinovic M, Pokorny B, Shah R, Anderson EC, Zhang K, Carel I, Bonitto K, Blelloch R, Fudenberg G, de Wit E, Nora EP. Science. 2025 Nov 27:eadt4221. doi: 10.1126/science.adt4221. 10.1126/science.adt4221 PubMed 41308125