pX330-U6-Chimeric_BB-CBh-hSpCas9
(Plasmid #42230)

• Purpose: A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.
• Depositing Lab: Feng Zhang
• Publication: Cong et al Science. 2013 Jan 3.
• Citations: 1959 Articles

Backbone

• Vector backbone: pUC ori vector
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Alt name: SpCas9
• Alt name: hSpCas9
• Insert Size (bp): 4272
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pSpCas9(BB) (PX330)

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/