Skip to main content

pET22b-T7-6h-GST-α-Synuclein
(Plasmid #225224)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225224 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET22b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5366
  • Total vector size (bp) 6506
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GST
  • Species
    E. coli
  • Insert Size (bp)
    654
  • GenBank ID
    914142
  • Entrez Gene
    GSTK1 (a.k.a. GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1)
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis Tag (N terminal on insert)
    • TEV Cleavage Site (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    α-Synuclein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    420
  • GenBank ID
    6622
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-T7-6h-GST-α-Synuclein was a gift from Urartu Seker (Addgene plasmid # 225224 ; http://n2t.net/addgene:225224 ; RRID:Addgene_225224)
  • For your References section:

    Synergistic Screening of Peptide-Based Biotechnological Drug Candidates for Neurodegenerative Diseases Using Yeast Display and Phage Display. Ozcelik CE, Begli O, Hincer A, Ahan RE, Kesici MS, Oguz O, Kasirga TS, Ozcubukcu S, Seker UOS. ACS Chem Neurosci. 2023 Oct 4;14(19):3609-3621. doi: 10.1021/acschemneuro.3c00248. Epub 2023 Aug 28. 10.1021/acschemneuro.3c00248 PubMed 37638647