Skip to main content

pcDNA3puro-mGFP-FXR1a-Ccmut (N202P-V361P)
(Plasmid #225457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225457 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 225457-D50 50 μg of DNA in Tris buffer $495
DNA 225457-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3-puro
  • Backbone manufacturer
    Mayr Lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FXR1 isoform a
  • Species
    H. sapiens (human)
  • Mutation
    N202P V361P
  • Entrez Gene
    FXR1 (a.k.a. CMYP9A, CMYP9B, FXR1P, MYOPMIL, MYORIBF)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Other

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3puro-mGFP-FXR1a-Ccmut (N202P-V361P) was a gift from Christine Mayr (Addgene plasmid # 225457 ; http://n2t.net/addgene:225457 ; RRID:Addgene_225457)
  • For your References section:

    The FXR1 network acts as signaling scaffold for actomyosin remodeling. Chen X, Fansler MM, Janjoš U, Ule J, Mayr C. Cell. 5 August 2024. doi: 10.1016/j.cell.2024.07.015. 10.1016/j.cell.2024.07.015 PubMed 37961296