Skip to main content

qTAG-C-mStayGold-Puro-CANX
(Plasmid #227281)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227281 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 227281-D50 50 μg of DNA in Tris buffer $495
DNA 227281-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2686
  • Vector type
    Mammalian Expression, CRISPR ; Donor Template
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CANX Homology Arms flanking a mStayGold-2A-Puro Cassette
  • Alt name
    CANX
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2669
  • Entrez Gene
    CANX (a.k.a. CNX, IP90, P90)
  • Promoter Promoterless

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
  • 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279): https://www.addgene.org/227279/

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    qTAG-C-mStayGold-Puro-CANX was a gift from Laurence Pelletier (Addgene plasmid # 227281 ; http://n2t.net/addgene:227281 ; RRID:Addgene_227281)
  • For your References section:

    qTAG: an adaptable plasmid scaffold for CRISPR-based endogenous tagging. Philip R, Sharma A, Matellan L, Erpf AC, Hsu WH, Tkach JM, Wyatt HDM, Pelletier L. EMBO J. 2024 Dec 12. doi: 10.1038/s44318-024-00337-5. 10.1038/s44318-024-00337-5 PubMed 39668248