pET-Impact-T4gp43(exo-)
(Plasmid
#228202)
-
PurposeExpression in BL21(DE3) of 3' to 5' exonuclease-deficient T4 DNA polymerase D219A
-
Depositing Lab
-
Depositing OrganizationPennsylvania State University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-Impact
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name43
-
SpeciesEscherichia phage T4
-
MutationMutated aspartate 219 to alanine (D219A), eliminates 3' to 5' exonuclease activity
- Promoter T7
-
Tag
/ Fusion Protein
- Sce VMA intein-chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Impact-T4gp43(exo-) was a gift from Stephen Benkovic (Addgene plasmid # 228202 ; http://n2t.net/addgene:228202 ; RRID:Addgene_228202)