pB-3xFlag-dCas13-mTET2CD
(Plasmid
#228234)
-
PurposeFor targeted tethering of the catalytic domain of mouse TET2 using dCas13
-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 228234-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 228234-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPB
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas13
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcggcggcgccgctagcccaaagaagaagcggaaagtcaacatc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTET2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2601
-
MutationCD (cysteine-rich, dioxygenase domain) truncation of mouse TET2 (contains aa's 1044-1921)
-
Entrez GeneTet2 (a.k.a. Ayu17-449, E130014J05Rik, mKIAA1546)
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gccgacggcagcgaattcggcaaatgtgaaggatgcaatccag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDavid Liu, pCMV-dCas13-M3nls (Addgene plasmid #155366 ; http://n2t.net/addgene:155366 ; RRID:Addgene_155366); and Yue Xiong, pcDNA3-FLAG-mTET2 (Addgene plasmid #89735 ; http://n2t.net/addgene:89735 ; RRID:Addgene_89735).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 228234-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 228234-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-3xFlag-dCas13-mTET2CD was a gift from Chuan He (Addgene plasmid # 228234 ; http://n2t.net/addgene:228234 ; RRID:Addgene_228234) -
For your References section:
RNA m(5)C oxidation by TET2 regulates chromatin state and leukaemogenesis. Zou Z, Dou X, Li Y, Zhang Z, Wang J, Gao B, Xiao Y, Wang Y, Zhao L, Sun C, Liu Q, Yu X, Wang H, Hong J, Dai Q, Yang FC, Xu M, He C. Nature. 2024 Oct 2. doi: 10.1038/s41586-024-07969-x. 10.1038/s41586-024-07969-x PubMed 39358506