This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Fuw-dCas9-Dnmt3a
(Plasmid #84476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84476 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 84476-LV Virus (1 mL at titer ≥ 5x10⁵ TU/mL)
and Plasmid. More Information
$250
Concentrated Lentiviral Prep 84476-LVC Virus (50 µL at titer ≥ 5×10⁶ TU/mL)
and Plasmid. More Information
$390

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW
  • Backbone size w/o insert (bp) 9207
  • Total vector size (bp) 16149
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-Dnmt3a
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    6933

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer aactatgcgctcggg
  • 3′ sequencing primer taaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Information for Lentiviral Prep (Catalog # 84476-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from Fuw-dCas9-Dnmt3a (#84476). In addition to the viral particles, you will also receive purified Fuw-dCas9-Dnmt3a plasmid DNA.

Lentiviral particles carrying dCas9 fused with Dnmt3a

Delivery

  • Volume 1 mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker Zeocin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84476-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the dCas9 protein and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward Primer: dCas9-fwd, ACCGTGTACAACGAGCTGAC
    • Reverse Primer: WPRE-R, CATAGCGTAAAAGGAGCAACA
  • Confirmation of protein expression: A549 cells were transduced with 84476-LV. 96 hours later, cells were fixed in 4% paraformaledyhyde and stained with 5 μg/mL anti-CRISPR Cas9 [7A9-3A3] (Abcam ab191468) primary antibody and Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (ThermoFisher R37114). Nuclei were counterstained with DAPI. Cas9 expression was confirmed by fluorescence microscopy.

Visit our viral production page for more information.

Information for Concentrated Lentiviral Prep (Catalog # 84476-LVC) ( Back to top )

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from Fuw-dCas9-Dnmt3a (#84476). In addition to the viral particles, you will also receive purified Fuw-dCas9-Dnmt3a plasmid DNA.

Concentrated lentiviral particles carrying dCas9 fused with Dnmt3a

Delivery

  • Volume 50 µL
  • Titer ≥5×10⁶ TU/mL
  • Pricing $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Zeocin
  • Purification Lentivirus was concentrated by precipitation in polyethylene glycol (PEG) followed by centrifugation.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84476-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
Notes:
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fuw-dCas9-Dnmt3a was a gift from Rudolf Jaenisch (Addgene plasmid # 84476)
  • For your References section:

    Editing DNA Methylation in the Mammalian Genome. Liu XS, Wu H, Ji X, Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R. Cell. 2016 Sep 22;167(1):233-247.e17. doi: 10.1016/j.cell.2016.08.056. 10.1016/j.cell.2016.08.056 PubMed 27662091