Fuw-dCas9-Tet1CD
(Plasmid #84475)

• Purpose: Lentiviral construct to express dCas9 fused with the catalytic domain of Tet1
• Depositing Lab: Rudolf Jaenisch
• Publication: Liu et al Cell. 2016 Sep 22;167(1):233-247.e17. doi: 10.1016/j.cell.2016.08.056.
• Sequence Information:

  • Depositor Sequences: None.
  • Addgene Sequences: Full (1) Partial (2)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	84475	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart
Lentiviral Prep	84475-LV	Virus (1 mL at titer ≥ 5x10⁵ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$250	Add to Cart
Concentrated Lentiviral Prep	84475-LVC	Virus (50 µL at titer ≥ 5×10⁷ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$390	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: FUW
  (Search Vector Database)
• Backbone size w/o insert (bp): 9213
• Total vector size (bp): 15573
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-Tet1CD
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 6351

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: aactatgcgctcggg
• 3′ sequencing primer: taaagcagcgtatcc

Resource Information

• Terms and Licenses:
  • UBMTA

Information for Lentiviral Prep (Catalog # 84475-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD (#84475). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD plasmid DNA.

Lentiviral particles carrying dCas9 fused with the catalytic domain of Tet1

Delivery

• Volume: 1 mL
• Titer: ≥5x10⁵ TU/mL
• Pricing: $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO SFM
• Selectable Marker: Zeocin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:

• Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84475-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting the Tet1CD protein. The PCR product was sequenced using the Sanger method to confirm the sequence.
  
  • Forward Primer: Tet1CD variant FP1, GCACCCTCAATGAAAATCGT
  • Reverse Primer: Tet1CD variant RP1, TTGATCTTGGCTTCCATTCC
  • Sequencing Forward Primer: Tet1CD variant SP1, TGGCTACACGATTAGCTCCA
  • Sequencing Reverse Primer: Tet1CD variant SP2, CATGGAGCTGCTCATCTTGA
• Confirmation of protein expression: A549 cells were transduced with 84475-LV. 96 hours later, cells were fixed in 4% paraformaledyhyde and stained with 5 μg/mL anti-CRISPR Cas9 [7A9-3A3] (Abcam ab191468) primary antibody and Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (ThermoFisher R37114). Nuclei were counterstained with DAPI. Cas9 expression was confirmed by fluorescence microscopy.

Visit our viral production page for more information.

Information for Concentrated Lentiviral Prep (Catalog # 84475-LVC)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD (#84475). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD plasmid DNA.

Lentiviral particles carrying dCas9 fused with the catalytic domain of Tet1

Delivery

• Volume: 50 µL
• Titer: ≥5×10⁷ TU/mL
• Pricing: $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: PBS
• Selectable Marker: Zeocin
• Purification: Lentivirus was concentrated by precipitation in polyethylene glycol (PEG) followed by centrifugation.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:

• Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84475-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.

Notes:

• Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.