This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84479)


Item Catalog # Description Quantity Price (USD)
Plasmid 84479 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 84479-LV Virus (1 mL at titer ≥ 5x10⁵ TU/mL)
and Plasmid. More Information
Concentrated Lentiviral Prep 84479-LVC Virus (50 µL at titer ≥ 5×10⁷ TU/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9213
  • Total vector size (bp) 15573
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin ; Resistance marker is outside the LTRs and will not be packaged into virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer aactatgcgctcggg
  • 3′ sequencing primer taaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

Information for Lentiviral Prep (Catalog # 84479-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD_IM (#84479). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD_IM plasmid DNA.

Lentiviral particles carrying dCas9 fused with an inactive catalytic domain of Tet1 (H1672Y, D1674A)


  • Volume 1 mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker None (Zeocin resistance is outside the LTRs and not transduced)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84479-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
  • PCR confirmation of insert: PCR was carried out with primers targeting the Tet1CD protein. The PCR product was sequenced using the Sanger method to confirm the sequence.
    • Forward Primer: Tet1CD variant FP1, GCACCCTCAATGAAAATCGT
    • Reverse Primer: Tet1CD variant RP1, TTGATCTTGGCTTCCATTCC
    • Sequencing Forward Primer: Tet1CD variant SP1, TGGCTACACGATTAGCTCCA
    • Sequencing Reverse Primer: Tet1CD variant SP2, CATGGAGCTGCTCATCTTGA
  • Confirmation of protein expression: A549 cells were transduced with 84479-LV. 96 hours later, cells were fixed in 4% paraformaledyhyde and stained with 5 μg/mL anti-CRISPR Cas9 [7A9-3A3] (Abcam ab191468) primary antibody and Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (ThermoFisher R37114). Nuclei were counterstained with DAPI. Cas9 expression was confirmed by fluorescence microscopy.

Visit our viral production page for more information.

Information for Concentrated Lentiviral Prep (Catalog # 84479-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from Fuw-dCas9-Tet1CD_IM (#84479). In addition to the viral particles, you will also receive purified Fuw-dCas9-Tet1CD_IM plasmid DNA.

Lentiviral particles carrying dCas9 fused with an inactive catalytic domain of Tet1 (H1672Y, D1674A)


  • Volume 50 µL
  • Titer ≥5×10⁷ TU/mL
  • Pricing $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker None (Zeocin resistance is outside the LTRs and not transduced)
  • Purification Lentivirus was concentrated by precipitation in polyethylene glycol (PEG) followed by centrifugation.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 84479-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fuw-dCas9-Tet1CD_IM was a gift from Rudolf Jaenisch (Addgene plasmid # 84479)

    For viral preps, please replace (Addgene plasmid # 84479) in the above sentence with: (Addgene viral prep # 84479-LV) or (Addgene viral prep # 84479-LVC)

  • For your References section:

    Editing DNA Methylation in the Mammalian Genome. Liu XS, Wu H, Ji X, Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R. Cell. 2016 Sep 22;167(1):233-247.e17. doi: 10.1016/j.cell.2016.08.056. 10.1016/j.cell.2016.08.056 PubMed 27662091