Skip to main content

Epac-S-H332
(Plasmid #228250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228250 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 228250-D50 50 μg of DNA in Tris buffer $495
DNA 228250-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 9846
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mT2Del_EPACdDEPCD_L777A_K778A_tdBlackcp173Venus(ST)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4445
  • Mutation
    Deletion of DEP domain, Catalytically dead T781A & F782A, no nuclear envelope affinity L777A & K778A
  • Entrez Gene
    RAPGEF3 (a.k.a. CAMP-GEFI, EPAC, EPAC1, HSU79275, bcm910)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CACGACTGGAGCCTCTTCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.30.615785 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Epac-S-H332 was a gift from Kees Jalink (Addgene plasmid # 228250 ; http://n2t.net/addgene:228250 ; RRID:Addgene_228250)
  • For your References section:

    Cytosolic-enhanced dark Epac-based FRET sensors allow for intracellular cAMP detection in live cells via FLIM. Zanetti G, Klarenbeek JB, Jalink K. FEBS Lett. 2024 Dec 31. doi: 10.1002/1873-3468.15093. 10.1002/1873-3468.15093 PubMed 39737677