CHGA-eGFP
(Plasmid
#228569)
-
PurposeExpresses GFP-tagged human Chromogranin A in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1(+)-C-eGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChromogranin-A
-
Alt nameCgA
-
Alt namePituitary secretory protein I (SP-I)
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001275.3
-
Entrez GeneCHGA (a.k.a. CGA, PHE5, PHES)
- Promoter cmv
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHGA-eGFP was a gift from Geert van den Bogaart (Addgene plasmid # 228569 ; http://n2t.net/addgene:228569 ; RRID:Addgene_228569) -
For your References section:
Inflammation Promotes Proteolytic Processing of the Prohormone Chromogranin A by Macrophages. Ioannidis M, van Dijk H, Muntjewerff EM, Chirasani VR, Warner H, van den Dool W, Grijpstra P, Bianchi F, Mahata SK, van den Bogaart G. J Endocr Soc. 2025 May 15;9(7):bvaf090. doi: 10.1210/jendso/bvaf090. eCollection 2025 Jul. 10.1210/jendso/bvaf090 PubMed 40458085