pX330-U6-MYC-Guide-hSpCas9
(Plasmid
#228574)
-
PurposeExpression of human MYC gRNA; CRISPR mediated gene insertion
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYC gRNA
-
gRNA/shRNA sequenceCACCGGGAGAGCTTGTGGACCGAGC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)25
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-U6-MYC-Guide-hSpCas9 was a gift from Marcin Imielinski (Addgene plasmid # 228574 ; http://n2t.net/addgene:228574 ; RRID:Addgene_228574)