FIREC-PBCS-MR3
(Plasmid
#228700)
-
PurposeControl cassette FIRE2, FIRE fluorescent ratiometric sensor
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 228700-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 228700-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonenonspecific
-
Vector typeMammalian Expression, Synthetic Biology, Unspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFIRE2 CONTROL
-
SpeciesSynthetic
- Promoter EF1-alpha
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ACATGCGTCAATTTTACGCATGATTATCTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 228700-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 228700-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FIREC-PBCS-MR3 was a gift from Carolyn Sangokoya (Addgene plasmid # 228700 ; http://n2t.net/addgene:228700 ; RRID:Addgene_228700) -
For your References section:
The FIRE biosensor illuminates iron regulatory protein activity and cellular iron homeostasis. Sangokoya C. Cell Rep Methods. 2025 Jan 11:100960. doi: 10.1016/j.crmeth.2024.100960. 10.1016/j.crmeth.2024.100960 PubMed 39824193