-
PurposeExpresses sfCherry2(1-10) fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfCherry2(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)624
-
Mutationchanged Glu 118 to Gln, changed Thr 128 to Ile
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CACAGTCGAGGCTGATCAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_sfCherry2(1-10) was a gift from Bo Huang (Addgene plasmid # 82602 ; http://n2t.net/addgene:82602 ; RRID:Addgene_82602) -
For your References section:
Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864