Luke-2
(Plasmid
#228900)
-
PurposeLuke-2 localizes to the inner cyst wall and ostioles of Acanthamoeba tagged with eGFP
-
Depositing Lab
-
Depositing OrganizationBoston University Medical Campus
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 228900-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 228900-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGAPDH
- Backbone size w/o insert (bp) 5655
- Total vector size (bp) 6501
-
Vector typeAcanthamoeba expression vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCarbohydrate binding domain cbm49 protein
-
Alt nameUncharacterized protein
-
SpeciesAcanthamoeba castellanii Neff
-
Mutationnone
-
GenBank IDXM_004337618.1
- Promoter Own
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGAAGCTTCTCTTCTGCTTGACCGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 228900-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 228900-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Luke-2 was a gift from John Samuelson (Addgene plasmid # 228900 ; http://n2t.net/addgene:228900 ; RRID:Addgene_228900) -
For your References section:
Cellulose binding and the timing of expression influence protein targeting to the double-layered cyst wall of Acanthamoeba. Kanakapura Sundararaj B, Goyal M, Samuelson J. mSphere. 2024 Sep 25;9(9):e0046624. doi: 10.1128/msphere.00466-24. Epub 2024 Aug 13. 10.1128/msphere.00466-24 PubMed 39136454