Skip to main content

pCDH-CB-Cdkn1a
(Plasmid #228914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228914 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 228914-D50 50 μg of DNA in Tris buffer $495
DNA 228914-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCDH-CB
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cdkn1a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    480
  • Entrez Gene
    Cdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggatccatgtccaatcctgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-CB-Cdkn1a was a gift from Sika Zheng (Addgene plasmid # 228914 ; http://n2t.net/addgene:228914 ; RRID:Addgene_228914)
  • For your References section:

    Epistatic interactions between NMD and TRP53 control progenitor cell maintenance and brain size. Lin L, Zhao J, Kubota N, Li Z, Lam YL, Nguyen LP, Yang L, Pokharel SP, Blue SM, Yee BA, Chen R, Yeo GW, Chen CW, Chen L, Zheng S. Neuron. 2024 Jul 3;112(13):2157-2176.e12. doi: 10.1016/j.neuron.2024.04.006. Epub 2024 May 1. 10.1016/j.neuron.2024.04.006 PubMed 38697111