pCDH-CB-Cdkn1a
(Plasmid
#228914)
-
PurposeExpression CDKN1A in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Riverside
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 228914-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 228914-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDH-CB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCdkn1a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)480
-
Entrez GeneCdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggatccatgtccaatcctgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 228914-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 228914-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CB-Cdkn1a was a gift from Sika Zheng (Addgene plasmid # 228914 ; http://n2t.net/addgene:228914 ; RRID:Addgene_228914) -
For your References section:
Epistatic interactions between NMD and TRP53 control progenitor cell maintenance and brain size. Lin L, Zhao J, Kubota N, Li Z, Lam YL, Nguyen LP, Yang L, Pokharel SP, Blue SM, Yee BA, Chen R, Yeo GW, Chen CW, Chen L, Zheng S. Neuron. 2024 Jul 3;112(13):2157-2176.e12. doi: 10.1016/j.neuron.2024.04.006. Epub 2024 May 1. 10.1016/j.neuron.2024.04.006 PubMed 38697111