fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0; cmlc2:EGFP
(Plasmid
#230075)
-
PurposePartial ablation using NTR2 and subsequent lineage tracing of regenerating hepatocytes in zebrafish.
-
Depositing Lab
-
Depositing OrganizationUniversite Libre de Bruxelles
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC57
-
Vector typeCre/Lox ; Zebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0
-
Alt nameBB-NTR2.0
-
SpeciesD. rerio (zebrafish); Aequorea victoria, Entacmaea quadricolor, Discosoma sp., Vibrio vulnificus
-
Insert Size (bp)4642
-
GenBank IDAAV52164 OP373690.1
- Promoter fabp10a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtcgtcaaatcctggtgcaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJeff Mumm: Sequence for NTR 2.0 was obtained from 5xUAS:GAP-mCherry-P2A-NfsB_Vv F70A/F108Y,he:tagBFP2 (Addgene Plasmid #158653). This sequence was used to synthesize the insert.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.23.655316 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0; cmlc2:EGFP was a gift from Sumeet Pal Singh (Addgene plasmid # 230075 ; http://n2t.net/addgene:230075 ; RRID:Addgene_230075) -
For your References section:
CellCousin2: an optimized system for partial ablation and tracing of regenerative lineages. Hovhannisyan GG, Akhourbi T, Eski SE, Pirson I, Gurzov EN, Singh SP. NPJ Regen Med. 2026 Mar 30. doi: 10.1038/s41536-026-00473-y. 10.1038/s41536-026-00473-y PubMed 41912583