Skip to main content

pYOY178
(Plasmid #23108)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 23108 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 23108-D50 50 μg of DNA in Tris buffer $495
DNA 23108-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4709
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mitotic Centromere Associated Kinesin
  • Alt name
    MCAK
  • Alt name
    Kif2C
  • Alt name
    Kinesin 13
  • Species
    Cricetulus griseus (Chinese hamster)
  • Insert Size (bp)
    2238
  • Mutation
    S92A, S106A, S108A, S112A, S186A
  • GenBank ID
    U11790
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer catggtcctgctggagttcgtg
  • 3′ sequencing primer TTTTAAAGCAAGTAAAACCTCTACAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYOY178 was a gift from Linda Wordeman (Addgene plasmid # 23108 ; http://n2t.net/addgene:23108 ; RRID:Addgene_23108)
  • For your References section:

    Aurora B regulates MCAK at the mitotic centromere. Andrews PD, Ovechkina Y, Morrice N, Wagenbach M, Duncan K, Wordeman L, Swedlow JR. Dev Cell. 2004 Feb . 6(2):253-68. 10.1016/S1534-5807(04)00025-5 PubMed 14960279