Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pYOY152
(Plasmid #13987)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13987 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4709
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mitotic Centromere Associated Kinesin
  • Alt name
    MCAK
  • Alt name
    Kif2C
  • Alt name
    Kinesin 13
  • Species
    Cricetulus griseus (Chinese hamster)
  • Insert Size (bp)
    2238
  • GenBank ID
    U11790
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer catggtcctgctggagttcgtg
  • 3′ sequencing primer TTTTAAAGCAAGTAAAACCTCTACAAA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYOY152 was a gift from Linda Wordeman (Addgene plasmid # 13987 ; http://n2t.net/addgene:13987 ; RRID:Addgene_13987)
  • For your References section:

    K-loop insertion restores microtubule depolymerizing activity of a "neckless" MCAK mutant. Ovechkina Y, Wagenbach M, Wordeman L. J Cell Biol. 2002 Nov 25. 159(4):557-62. 10.1083/jcb.200205089 PubMed 12446739