pMX222
(Plasmid
#23109)
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 23109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 23109-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 23109-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4709
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitotic Centromere Associated Kinesin
-
Alt nameMCAK
-
Alt nameKif2C
-
Alt nameKinesin 13
-
SpeciesCricetulus griseus (Chinese hamster)
-
Insert Size (bp)2238
-
MutationS92E, S106E, S108E, S112E, S186E
-
GenBank IDU11790
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer catggtcctgctggagttcgtg
- 3′ sequencing primer TTTTAAAGCAAGTAAAACCTCTACAAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 23109-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 23109-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX222 was a gift from Linda Wordeman (Addgene plasmid # 23109 ; http://n2t.net/addgene:23109 ; RRID:Addgene_23109) -
For your References section:
Aurora B regulates MCAK at the mitotic centromere. Andrews PD, Ovechkina Y, Morrice N, Wagenbach M, Duncan K, Wordeman L, Swedlow JR. Dev Cell. 2004 Feb . 6(2):253-68. 10.1016/S1534-5807(04)00025-5 PubMed 14960279