pJS15A-pRpsl8-adhT
(Plasmid
#231852)
-
PurposeExpression of adhT (from Parageobacillus thermoglucosidasius) under the control of Rpsl8 promoter
-
Depositing Lab
-
Depositing OrganizationWageningen University, Department Agrotechnology & Food Sciences
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231852 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJS15A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameadhT
-
SpeciesParageobacillus thermoglucosidasius
- Promoter pRpsl8
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGATTGTGAAATTGAATTCGAGCTGACAATCGTTAAAGCGGACGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.31.621308 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJS15A-pRpsl8-adhT was a gift from Nico Claassens (Addgene plasmid # 231852 ; http://n2t.net/addgene:231852 ; RRID:Addgene_231852) -
For your References section:
Awakening of the RuMP cycle for partial methylotrophy in the thermophile Parageobacillus thermoglucosidasius. Paredes-Barrada M, Mathissen A, van der Molen RA, Jimenez-Huesa PJ, Polano ME, Donati S, Abele M, Ludwig C, van Kranenburg R, Claassens NJ. Metab Eng. 2025 Sep;91:145-157. doi: 10.1016/j.ymben.2025.04.002. Epub 2025 Apr 15. 10.1016/j.ymben.2025.04.002 PubMed 40245979