pLV-UbC-Tet1v4-dCas9
(Plasmid
#232180)
-
PurposeTet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 16300
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR
-
Alt nameTET1 catalytic domain
-
SpeciesH. sapiens (human); S. pyogenes
-
Insert Size (bp)4100
-
MutationD10A, H840A
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter hUbC
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aagttttttaggcaccttttgaaatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTet1-XTEN80-dCas9 sequence from Addgene plasmid #167983 was amplified for insertion into lentiviral expression vector containing BSD
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.03.583177 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-UbC-Tet1v4-dCas9 was a gift from Charles Gersbach (Addgene plasmid # 232180 ; http://n2t.net/addgene:232180 ; RRID:Addgene_232180) -
For your References section:
Activation of the imprinted Prader-Willi syndrome locus by CRISPR-based epigenome editing. Rohm D, Black JB, McCutcheon SR, Barrera A, Berry SS, Morone DJ, Nuttle X, de Esch CE, Tai DJC, Talkowski ME, Iglesias N, Gersbach CA. Cell Genom. 2025 Feb 12;5(2):100770. doi: 10.1016/j.xgen.2025.100770. 10.1016/j.xgen.2025.100770 PubMed 39947136