pRSF-G1(4FF)RS
(Plasmid
#232254)
-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 4-Fluoro-L-Phenylalanine (4FF) into proteins in E. coli in response to the amber (TAG) codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSF
- Backbone size w/o insert (bp) 2452
- Total vector size (bp) 3274
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametRNA synthetase
-
Alt nameG1(4FF)RS
-
SpeciesMethanogenic archaeon ISO4-G1
-
Insert Size (bp)822
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-G1(4FF)RS was a gift from Thomas Huber (Addgene plasmid # 232254 ; http://n2t.net/addgene:232254 ; RRID:Addgene_232254) -
For your References section:
Genetic Encoding of Fluorinated Analogues of Phenylalanine for (19)F NMR Spectroscopy: Detection of Conformational Heterogeneity in Flaviviral NS2B-NS3 Proteases. Qianzhu H, Tan YJ, Abdelkader EH, Huber T, Otting G. ACS Sens. 2025 Apr 25;10(4):3152-3161. doi: 10.1021/acssensors.5c00432. Epub 2025 Apr 1. 10.1021/acssensors.5c00432 PubMed 40168619