Skip to main content

pAAV-CAG-NES-jRGECO1-P2A-mGreenLantern
(Plasmid #232844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232844 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NES-jRGECO1
  • Species
    Synthetic
  • Insert Size (bp)
    1410
  • Promoter CAG
  • Tag / Fusion Protein
    • nuclear export sequence, 6xHis, T7, Xpress tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer ggcaaagaattggatccggtaccgccacc
  • 3′ sequencing primer acgaagagtttgtacaaatgatgacagcgaagCGACCGGTTCACGTGGGAAGTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mGreenLantern
  • Species
    Synthetic
  • Insert Size (bp)
    717

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-NES-jRGECO1-P2A-mGreenLantern was a gift from Kiryl Piatkevich (Addgene plasmid # 232844 ; http://n2t.net/addgene:232844 ; RRID:Addgene_232844)
  • For your References section:

    A sensitive soma-localized red fluorescent calcium indicator for in vivo imaging of neuronal populations at single-cell resolution. Zhou S, Zhu Q, Eom M, Fang S, Subach OM, Ran C, Alvarado JS, Sunkavalli PS, Dong Y, Wang Y, Hu J, Zhang H, Wang Z, Sun X, Yang T, Mu Y, Yoon YG, Guo ZV, Subach FV, Piatkevich KD. PLoS Biol. 2025 Apr 29;23(4):e3003048. doi: 10.1371/journal.pbio.3003048. eCollection 2025 Apr. 10.1371/journal.pbio.3003048 PubMed 40299972