pAK208_2xBRD9BD-IFP2.0C
(Plasmid
#233734)
-
PurposeExpresses BRD9 Bromodomain as tandem double domain fused to C-terminal part of IFP2.0 for histone acetylation detection in BiAD sensors
-
Depositing Lab
-
Depositing OrganizationUniversitaet Stuttgart
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBRD9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)766
-
MutationBromodomain cloned twice in tandem
-
Entrez GeneBRD9 (a.k.a. LAVS3040, PRO9856, SMARCI2)
- Promoter CMV
-
Tag
/ Fusion Protein
- IFP2.0 C-terminal part (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid 215750
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Exchange of 2xHP1bCD insert by 2xBRD9BD
Please visit https://doi.org/10.1101/2025.02.10.637448 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAK208_2xBRD9BD-IFP2.0C was a gift from Albert Jeltsch (Addgene plasmid # 233734 ; http://n2t.net/addgene:233734 ; RRID:Addgene_233734) -
For your References section:
Development of a BiAD Sensor for Locus-Specific Detection of Cellular Histone Acetylation Dynamics by Fluorescence Microscopy. Kohler AR, Gutekunst N, Harsch A, Bashtrykov P, Jeltsch A. Genes (Basel). 2025 Apr 10;16(4):444. doi: 10.3390/genes16040444. 10.3390/genes16040444 PubMed 40282404