Skip to main content

FEOX-PBCS-TBF2- MC2
(Plasmid #234406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234406 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 234406-D50 50 μg of DNA in Tris buffer $495
DNA 234406-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    custom
  • Backbone size w/o insert (bp) 3871
  • Total vector size (bp) 8023
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    FEOX1 CONTROL
  • Alt name
    mCherry
  • Species
    Synthetic
  • Promoter hpgk

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (destroyed during cloning)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer TGTTCCGCATTCTGCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FEOX
  • Species
    Synthetic
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • mTagBFP2 (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (destroyed during cloning)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FEOX-PBCS-TBF2- MC2 was a gift from Carolyn Sangokoya (Addgene plasmid # 234406 ; http://n2t.net/addgene:234406 ; RRID:Addgene_234406)
  • For your References section:

    The genetically encoded biosensor FEOX is a molecular gauge for cellular iron environment dynamics at single cell resolution. Sangokoya C. Sci Rep. 2025 Oct 21;15(1):36596. doi: 10.1038/s41598-025-20428-5. 10.1038/s41598-025-20428-5 PubMed 41120533