Skip to main content
Addgene
Open Menu

pLenti CMV SNAT2-eGFP WT (wildtype)
(Plasmid #237226)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237226 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pLenti CMV Blast DEST (706-1)
  • Backbone manufacturer
    Eric Campeau, Paul Kaufman (Addgene plasmid #17451)
  • Backbone size w/o insert (bp) 9331
  • Total vector size (bp) 9966
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC38A2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2274
  • Mutation
    Silent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG
  • GenBank ID
  • Entrez Gene
    SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV SNAT2-eGFP WT (wildtype) was a gift from Seth Parker (Addgene plasmid # 237226 ; http://n2t.net/addgene:237226 ; RRID:Addgene_237226)

  • For your References section:

    N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970
Related items: