pLenti CRISPRv2 sgSLC38A2#1
(Plasmid
#237230)
-
PurposePlasmid for SNAT2 (SLC38A2) CRISPR knockout in human cell lines.
-
Depositing Lab
-
Depositing OrganizationUniversity of British Columbia
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLentiCRISPRv2
-
Backbone manufacturerFeng Zhang (Addgene plasmid #52961)
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13013
-
Modifications to backboneInserted the SLC38A2 targeted sgRNA sequence: TAATCTGAGCAATGCGATTG using BsmB1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInserted sgRNA targetting SLC38A2
-
gRNA/shRNA sequenceTAATCTGAGCAATGCGATTG
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Entrez GeneSLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (unknown if destroyed)
- 3′ cloning site BsmB1 (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (U6)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CRISPRv2 sgSLC38A2#1 was a gift from Seth Parker (Addgene plasmid # 237230 ; http://n2t.net/addgene:237230 ; RRID:Addgene_237230) -
For your References section:
N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970