Skip to main content
Addgene
Open Menu

pLenti CRISPRv2 sgSLC38A2#1
(Plasmid #237230)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237230 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid #52961)
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13013
  • Modifications to backbone
    Inserted the SLC38A2 targeted sgRNA sequence: TAATCTGAGCAATGCGATTG using BsmB1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Inserted sgRNA targetting SLC38A2
  • gRNA/shRNA sequence
    TAATCTGAGCAATGCGATTG
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (unknown if destroyed)
  • 3′ cloning site BsmB1 (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5' (U6)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CRISPRv2 sgSLC38A2#1 was a gift from Seth Parker (Addgene plasmid # 237230 ; http://n2t.net/addgene:237230 ; RRID:Addgene_237230)

  • For your References section:

    N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970
Related items: