pDONR221 SNAT2-eGFP 3NQ
(Plasmid
#237232)
-
PurposeDonor vector for gateway cloning of sgRNA-resistant SNAT2 (SLC38A2) cDNA sequence containing C-terminal eGFP. SNAT2 sequence contains mutations to inhibit N-linked glycosylation.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR221
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4761
- Total vector size (bp) 4824
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC38A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2274
-
MutationSilent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG; 3 asparagine residues mutated to glutamine to inhibit N-linked glycosylation: N254Q, N258Q, N274Q
-
Entrez GeneSLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
-
Tag
/ Fusion Protein
- eGFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward
- 3′ sequencing primer M13 Reverse
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR221 SNAT2-eGFP 3NQ was a gift from Seth Parker (Addgene plasmid # 237232 ; http://n2t.net/addgene:237232 ; RRID:Addgene_237232) -
For your References section:
N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970
Map uploaded by the depositor.
