Skip to main content

pDONR221 SNAT2-eGFP 3NQ
(Plasmid #237232)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237232 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDONR221
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4761
  • Total vector size (bp) 4824
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC38A2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2274
  • Mutation
    Silent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG; 3 asparagine residues mutated to glutamine to inhibit N-linked glycosylation: N254Q, N258Q, N274Q
  • Entrez Gene
    SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
  • Tag / Fusion Protein
    • eGFP

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR221 SNAT2-eGFP 3NQ was a gift from Seth Parker (Addgene plasmid # 237232 ; http://n2t.net/addgene:237232 ; RRID:Addgene_237232)
  • For your References section:

    N-linked glycosylation regulates SNAT2 trafficking and stability in pancreatic ductal adenocarcinoma cells. Koe JC, Pashaoskooie K, Johal D, Zhong YC, Wu C, Parker SJ. Am J Physiol Cell Physiol. 2026 Jun 29. doi: 10.1152/ajpcell.00060.2026. 10.1152/ajpcell.00060.2026 PubMed 42370970