pSplit-EX-3xHA-RAB7A
(Plasmid
#239112)
-
PurposeMammalian expression of canis RAB7A tagged with Split-EX-3xHA on the N terminus
-
Depositing Lab
-
Depositing OrganizationUtrecht University
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239112 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 4898
-
Modifications to backboneEGFP was removed
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRAB7A
-
SpeciesCanis lupus familaris
-
Insert Size (bp)624
-
Entrez GeneRAB7A (a.k.a. RAB7)
- Promoter CMV
-
Tag
/ Fusion Protein
- SplitEX-3xHA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab7a sequence was PCR amplified from GFP-Rab7 (Hoogenraad, C. C. et al. Neuron specific Rab4 effector GRASP-1 coordinates membrane specialization and maturation of recycling endosomes. PLoS Biol. 8, e1000283 (2010))
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSplit-EX-3xHA-RAB7A was a gift from Ginny Farias (Addgene plasmid # 239112 ; http://n2t.net/addgene:239112 ; RRID:Addgene_239112) -
For your References section:
ER - lysosome contacts at a pre-axonal region regulate axonal lysosome availability. Ozkan N, Koppers M, van Soest I, van Harten A, Jurriens D, Liv N, Klumperman J, Kapitein LC, Hoogenraad CC, Farias GG. Nat Commun. 2021 Jul 23;12(1):4493. doi: 10.1038/s41467-021-24713-5. 10.1038/s41467-021-24713-5 PubMed 34301956