Skip to main content
Addgene
Open Menu

pSplit-EX-3xHA-RAB7A
(Plasmid #239112)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239112 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 4898
  • Modifications to backbone
    EGFP was removed
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RAB7A
  • Species
    Canis lupus familaris
  • Insert Size (bp)
    624
  • Entrez Gene
    RAB7A (a.k.a. RAB7)
  • Promoter CMV
  • Tag / Fusion Protein
    • SplitEX-3xHA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab7a sequence was PCR amplified from GFP-Rab7 (Hoogenraad, C. C. et al. Neuron specific Rab4 effector GRASP-1 coordinates membrane specialization and maturation of recycling endosomes. PLoS Biol. 8, e1000283 (2010))

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSplit-EX-3xHA-RAB7A was a gift from Ginny Farias (Addgene plasmid # 239112 ; http://n2t.net/addgene:239112 ; RRID:Addgene_239112)

  • For your References section:

    ER - lysosome contacts at a pre-axonal region regulate axonal lysosome availability. Ozkan N, Koppers M, van Soest I, van Harten A, Jurriens D, Liv N, Klumperman J, Kapitein LC, Hoogenraad CC, Farias GG. Nat Commun. 2021 Jul 23;12(1):4493. doi: 10.1038/s41467-021-24713-5. 10.1038/s41467-021-24713-5 PubMed 34301956
Related items: