Skip to main content
Addgene
Open Menu

pRA-3xHA-Protrudin (Human ZFYVE27)
(Plasmid #239114)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239114 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6048
  • Modifications to backbone
    EGFP was removed
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ZFYVE27
  • Alt name
    Protrudin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1233
  • Entrez Gene
    ZFYVE27 (a.k.a. PROTRUDIN, SPG33)
  • Promoter CMV
  • Tag / Fusion Protein
    • RA-3xHA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    To generate GB-V5-C1 vector, GB and V5 fragments were amplified from GB-NES (Addgene #61017) and Split-AP-V5-C1 vector, respectively. To generate RA-HA-C1, RA and HA fragments were amplified from RA-NES45 (Addgene #61019) and Split-EX-HA-C1 vector, respectively. To generate RA-HA-protrudin, human protrudin sequences were amplified from IMAGE 4818199 (SourceBioScience). Protrudin was cloned into RA-HA-C1 between XhoI and EcoR1 sites, by GIBSON assembly.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRA-3xHA-Protrudin (Human ZFYVE27) was a gift from Ginny Farias (Addgene plasmid # 239114 ; http://n2t.net/addgene:239114 ; RRID:Addgene_239114)

  • For your References section:

    ER - lysosome contacts at a pre-axonal region regulate axonal lysosome availability. Ozkan N, Koppers M, van Soest I, van Harten A, Jurriens D, Liv N, Klumperman J, Kapitein LC, Hoogenraad CC, Farias GG. Nat Commun. 2021 Jul 23;12(1):4493. doi: 10.1038/s41467-021-24713-5. 10.1038/s41467-021-24713-5 PubMed 34301956
Related items: