pHAGE2-palm-mScar3-10xSunTag
(Plasmid
#240626)
-
PurposeExpresses a fusion construct containing a palmitoylation motif, mScarlet3 and 10 repeats of the SunTag (GCN4) peptide, to luminally tag extracellular vesicles for use in EV-FUSIM assay.
-
Depositing Lab
-
Depositing OrganizationUtrecht University
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 8190
- Total vector size (bp) 9697
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepalm-mScarlet3-10xSunTag
-
SpeciesSynthetic
-
Insert Size (bp)1506
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a minor discrepancy between the Addgene NGS sequence and the depositor sequence: LoxP site present in reference sequence, but absent in Addgene NGS sequence. Depositor confirms this is not of concern for plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-palm-mScar3-10xSunTag was a gift from Esther Nolte-'t Hoen (Addgene plasmid # 240626 ; http://n2t.net/addgene:240626 ; RRID:Addgene_240626) -
For your References section:
Development of a Live-Cell Imaging Assay to Elucidate Spatiotemporal Dynamics of Extracellular Vesicle Fusion with Target Cells. van den Ende J, Defourny KAY, Rabouw HH, Tanenbaum ME, Wubbolts RW, Nolte-'t Hoen ENM. J Extracell Vesicles. 2026 Mar;15(3):e70228. doi: 10.1002/jev2.70228. 10.1002/jev2.70228 PubMed 41764601