MTS-DDX28(IDR)-mCh-CRY2olig
(Plasmid
#241146)
-
PurposeExpresses mt-optoIDR with DDX28 (1-127 aa) to optogenetically induce biomolecular condensates within mitochondrial matrix in living cells.
-
Depositing Lab
-
Depositing OrganizationPennsylvania State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 6657
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDDX28
-
Alt nameMDDX28
-
Alt nameFLJ11282
-
Alt nameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)381
-
Mutationamino acids 1-127 only
-
GenBank IDNM_018380.4
-
Entrez GeneDDX28 (a.k.a. MDDX28)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry-Cry2olig (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.06.658068 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MTS-DDX28(IDR)-mCh-CRY2olig was a gift from Marina Feric (Addgene plasmid # 241146 ; http://n2t.net/addgene:241146 ; RRID:Addgene_241146) -
For your References section:
Membranes arrest the coarsening of mitochondrial condensates in human cells. Aththawala Gedara SVBD, Penna ST, Feric M. Commun Biol. 2026 Apr 23. doi: 10.1038/s42003-026-10085-3. 10.1038/s42003-026-10085-3 PubMed 42026137