pEMF044
(Plasmid #242105)

• Purpose: Non-replicative plasmid for random insertion of a Tn5 transposon with tetA and sacB gene (sacB-1)
• Depositing Lab: Christopher Johnson
• Publication: Fulk et al Nucleic Acids Res. 2026 Jul 17;54(14):gkag753. doi: 10.1093/nar/gkag753.

Backbone

• Vector backbone: pKMW7
• Backbone size w/o insert (bp): 3663
• Total vector size (bp): 6322
• Modifications to backbone: Replaced Tn5 promoter with Plac Moved KanR and R6K ori outside of transposon cargo region
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: Potentially toxic at high copy number; recommend propagation in strain with wild-type (low-copy) variant of pir gene
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: TcR
• Alt name: tetA
• Alt name: tetracycline efflux MFS transporter
• Species: Escherichia coli
• Insert Size (bp): 1200
• GenBank ID: HAJ8325295.1 HAJ8325295.1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tttttttactagtattgcgttgcgctcactgcccgctttc

Gene/Insert 2

• Gene/Insert name: sacB-1
• Alt name: levan sucrase
• Insert Size (bp): 1422

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: F_primer

Resource Information

• A portion of this plasmid was derived from a plasmid made by: *The Tn5 transposase, R6K ori, oriT, and KanR were derived from pKMW7 as described in: Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. Wetmore KM, Price MN, Waters RJ, Lamson JS, He J, Hoover CA, Blow MJ, Bristow J, Butland G, Arkin AP, Deutschbauer A. mBio. 2015 May 12;6(3):e00306-15. doi: 10.1128/mBio.00306-15. *sacB-1 was obtained from pK18msB (Addgene plasmid # 177839) as described in: Muconic acid production from glucose and xylose in Pseudomonas putida via evolution and metabolic engineering. Ling C, Peabody GL, Salvachua D, Kim YM, Kneucker CM, Calvey CH, Monninger MA, Munoz NM, Poirier BC, Ramirez KJ, St John PC, Woodworth SP, Magnuson JK, Burnum-Johnson KE, Guss AM, Johnson CW, Beckham GT. Nat Commun. 2022 Aug 22;13(1):4925. doi: 10.1038/s41467-022-32296-y.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see the annotated map in the Supplementary Documents section.