pEMF044
(Plasmid
#242105)
-
PurposeNon-replicative plasmid for random insertion of a Tn5 transposon with tetA and sacB gene (sacB-1)
-
Depositing Lab
-
Depositing OrganizationNational Laboratory of the Rockies (NLR)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKMW7
- Backbone size w/o insert (bp) 3663
- Total vector size (bp) 6322
-
Modifications to backboneReplaced Tn5 promoter with Plac Moved KanR and R6K ori outside of transposon cargo region
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsPotentially toxic at high copy number; recommend propagation in strain with wild-type (low-copy) variant of pir gene
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameTcR
-
Alt nametetA
-
Alt nametetracycline efflux MFS transporter
-
SpeciesEscherichia coli
-
Insert Size (bp)1200
-
GenBank IDHAJ8325295.1 HAJ8325295.1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tttttttactagtattgcgttgcgctcactgcccgctttc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesacB-1
-
Alt namelevan sucrase
-
Insert Size (bp)1422
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer F_primer
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by*The Tn5 transposase, R6K ori, oriT, and KanR were derived from pKMW7 as described in: Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. Wetmore KM, Price MN, Waters RJ, Lamson JS, He J, Hoover CA, Blow MJ, Bristow J, Butland G, Arkin AP, Deutschbauer A. mBio. 2015 May 12;6(3):e00306-15. doi: 10.1128/mBio.00306-15. *sacB-1 was obtained from pK18msB (Addgene plasmid # 177839) as described in: Muconic acid production from glucose and xylose in Pseudomonas putida via evolution and metabolic engineering. Ling C, Peabody GL, Salvachua D, Kim YM, Kneucker CM, Calvey CH, Monninger MA, Munoz NM, Poirier BC, Ramirez KJ, St John PC, Woodworth SP, Magnuson JK, Burnum-Johnson KE, Guss AM, Johnson CW, Beckham GT. Nat Commun. 2022 Aug 22;13(1):4925. doi: 10.1038/s41467-022-32296-y.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see the annotated map in the Supplementary Documents section.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMF044 was a gift from Christopher Johnson (Addgene plasmid # 242105 ; http://n2t.net/addgene:242105 ; RRID:Addgene_242105) -
For your References section:
Cas3-mediated genome reduction: demonstration in Cupriavidus necator H16 improves growth on heterotrophic and autotrophic carbon sources. Fulk EM, Swart RM, Nakamura AK, Quinto LB, Sanchez I Nogue V, Calvey CH, Tharun I, Isaacs FJ, Johnson CW. Nucleic Acids Res. 2026 Jul 17;54(14):gkag753. doi: 10.1093/nar/gkag753. 10.1093/nar/gkag753 PubMed 42549571