pEMF049
(Plasmid
#242190)
-
PurposeReplicative plasmid for rhamnose-inducible expression of Cascade-cas3 with crRNA targeting sacB-1
-
Depositing Lab
-
Depositing OrganizationNational Laboratory of the Rockies (NLR)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEMF047
- Backbone size w/o insert (bp) 11529
- Total vector size (bp) 11539
-
Modifications to backboneInsertion of sacB-1 crRNA target sequence
-
Vector typeBacterial Expression, CRISPR
-
Selectable markersKanR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namerhaR
-
Alt namerhaC1
-
gRNA/shRNA sequencen/a
-
SpeciesEscherichia coli
-
Insert Size (bp)849
-
GenBank ID
Gene/Insert 2
-
Gene/Insert namerhaS
-
Alt namerhaC2
-
gRNA/shRNA sequencen/a
-
SpeciesEscherichia coli
-
Insert Size (bp)837
Gene/Insert 3
-
Gene/Insert namePrhaBAD
-
gRNA/shRNA sequencen/a
-
Insert Size (bp)36
Gene/Insert 4
-
Gene/Insert nameI-C crRNA
-
gRNA/shRNA sequencecgtcagatgtaaatgtggctgaacctgaccattc
-
Insert Size (bp)88
Gene/Insert 5
-
Gene/Insert nameCas3
-
gRNA/shRNA sequencen/a
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)2235
Gene/Insert 6
-
Gene/Insert nameCas5
-
gRNA/shRNA sequencen/a
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)654
Gene/Insert 7
-
Gene/Insert nameCas8
-
gRNA/shRNA sequencen/a
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)1764
Gene/Insert 8
-
Gene/Insert nameCas7
-
gRNA/shRNA sequencen/a
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)870
Resource Information
-
A portion of this plasmid was derived from a plasmid made byrhaSR and rhanmonse-inducible expression of crRNA, cas3, cas5, cas8, and cas7 were derived from pCas3cRh (Addgene #133773) as described in: A compact Cascade-Cas3 system for targeted genome engineering. Csorgo B, Leon LM, Chau-Ly IJ, Vasquez-Rifo A, Berry JD, Mahendra C, Crawford ED, Lewis JD, Bondy-Denomy J. Nat Methods. 2020 Oct 19. pii: 10.1038/s41592-020-00980-w. doi: 10.1038/s41592-020-00980-w.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see the annotated map in the Supplementary Documents section.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMF049 was a gift from Christopher Johnson (Addgene plasmid # 242190 ; http://n2t.net/addgene:242190 ; RRID:Addgene_242190) -
For your References section:
Cas3-mediated genome reduction: demonstration in Cupriavidus necator H16 improves growth on heterotrophic and autotrophic carbon sources. Fulk EM, Swart RM, Nakamura AK, Quinto LB, Sanchez I Nogue V, Calvey CH, Tharun I, Isaacs FJ, Johnson CW. Nucleic Acids Res. 2026 Jul 17;54(14):gkag753. doi: 10.1093/nar/gkag753. 10.1093/nar/gkag753 PubMed 42549571