pEMF049
(Plasmid #242190)

• Purpose: Replicative plasmid for rhamnose-inducible expression of Cascade-cas3 with crRNA targeting sacB-1
• Depositing Lab: Christopher Johnson
• Publication: Fulk et al Nucleic Acids Res. 2026 Jul 17;54(14):gkag753. doi: 10.1093/nar/gkag753.

Backbone

• Vector backbone: pEMF047
• Backbone size w/o insert (bp): 11529
• Total vector size (bp): 11539
• Modifications to backbone: Insertion of sacB-1 crRNA target sequence
• Vector type: Bacterial Expression, CRISPR
• Selectable markers: KanR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: rhaR
• Alt name: rhaC1
• gRNA/shRNA sequence: n/a
• Species: Escherichia coli
• Insert Size (bp): 849
• GenBank ID:

Gene/Insert 2

• Gene/Insert name: rhaS
• Alt name: rhaC2
• gRNA/shRNA sequence: n/a
• Species: Escherichia coli
• Insert Size (bp): 837

Gene/Insert 3

• Gene/Insert name: PrhaBAD
• gRNA/shRNA sequence: n/a
• Insert Size (bp): 36

Gene/Insert 4

• Gene/Insert name: I-C crRNA
• gRNA/shRNA sequence: cgtcagatgtaaatgtggctgaacctgaccattc
• Insert Size (bp): 88

Gene/Insert 5

• Gene/Insert name: Cas3
• gRNA/shRNA sequence: n/a
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 2235

Gene/Insert 6

• Gene/Insert name: Cas5
• gRNA/shRNA sequence: n/a
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 654

Gene/Insert 7

• Gene/Insert name: Cas8
• gRNA/shRNA sequence: n/a
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 1764

Gene/Insert 8

• Gene/Insert name: Cas7
• gRNA/shRNA sequence: n/a
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 870

Resource Information

• A portion of this plasmid was derived from a plasmid made by: rhaSR and rhanmonse-inducible expression of crRNA, cas3, cas5, cas8, and cas7 were derived from pCas3cRh (Addgene #133773) as described in: A compact Cascade-Cas3 system for targeted genome engineering. Csorgo B, Leon LM, Chau-Ly IJ, Vasquez-Rifo A, Berry JD, Mahendra C, Crawford ED, Lewis JD, Bondy-Denomy J. Nat Methods. 2020 Oct 19. pii: 10.1038/s41592-020-00980-w. doi: 10.1038/s41592-020-00980-w.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see the annotated map in the Supplementary Documents section.