pCMV-QS
(Plasmid #24340)

• Depositing Lab: Liqun Luo
• Depositing Organization: Stanford University
  Located in the United States of America
• Publication: Potter et al Cell. 2010 Apr 30. 141(3):536-48.

Backbone

• Vector backbone: pcDNA3.1-Myc-His-A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5493
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QS
• Species: Neurospora crassa
• Insert Size (bp): 2750
• Tags / Fusion Proteins:
  • Myc (C terminal on insert)
  • His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Acc65I (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CMV-F

Resource Information

• Additional Resources:
  • pCMV-QS (GenBank)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

QS cDNA was obtained by PCR using primers PR53
(aatggtacccaacatgaacaccatcccggcac) and PR54 (aatgcggccgctcaagatatttgcgttgcaattc) using a
cosmid, pLorist-HO35F3 from the Fungal Genetics Stock Center, as the template. The PCR
fragment was initially cloned into pPAC5C-PL using Acc65 I and NotI to obtain the QS gene
containing a single intron. The intron was subsequently removed by creating two PCR products that
were cloned using 3-way ligation into pCDNA3.1-Mys-His-A (Invitrogen) using Acc65I and NotI and
blunt ends at the exon-exon junction. The primers used to create the first exon are: PR53 (see
above) + PR190 (agagcctagaggtactctgtgggcgg); and the second exon are: PR58
(tggtcggcgcccaattcc) + PR54 (see above).

A stop codon precedes the Myc and His tags.

DNA (Catalog # 24340-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 24340-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.