pAAV_hSyn1_DIO_TVA66T_P2A_EGFP_P2A_N2cG
(Plasmid
#244253)
-
PurposeAAV plasmid containing hSyn driven DIO expression of TVA66T receptor, EGFP, and CVS rabies N2c glycoprotein
-
Depositing Lab
-
Depositing OrganizationYale University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTVA receptor 66T
-
SpeciesALV-A
-
Insert Size (bp)540
- Promoter hSyn
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCGGCATGGTGCGGTTGTTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CTGGTCGAGCTGGACGGCGACG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameN2cG
-
Alt nameN2c glycoprotein
-
SpeciesRabies virus
-
Insert Size (bp)1575
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ggttcctcaggttcttttgtttg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hSyn1_DIO_TVA66T_P2A_EGFP_P2A_N2cG was a gift from Tristan Geiller (Addgene plasmid # 244253 ; http://n2t.net/addgene:244253 ; RRID:Addgene_244253)