Skip to main content
Addgene
Open Menu

pDONR-HA1/NELFCD/FKBP/PURO/HA2
(Plasmid #244455)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 244455 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pBluescript II SK(-)
  • Total vector size (bp) 5584
  • Vector type
    Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    NELFCD homology arm 1
  • Species
    H. sapiens (human)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctatagggcgaattgggtacATGTTGGAGATGGGTGGTG
  • 3′ sequencing primer gcccgagccaccgccaccGTTCACCATGATGAAGTTAGATTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    F36V mutant of FK506-binding protein FKBP12 with puromycin and 2xHA

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tggaggatgctctaaattaGGCACCGGGCTTGCGGGTC
  • 3′ sequencing primer tgacccgcaagcccggtgcctaatttagagcatcctccagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR-HA1/NELFCD/FKBP/PURO/HA2 was a gift from Lea Gregersen (Addgene plasmid # 244455 ; http://n2t.net/addgene:244455 ; RRID:Addgene_244455)

  • For your References section:

    Oxidative stress triggers RNAPII arrest through PARylation and DNA damage. Thomas QA, Wu L, Lesage E, Iversen HKM, Lopez Martinez D, Kompocholi S, Liu H, Nieto Moreno N, Gregersen LH. Nat Commun. 2026 Aug 10;17(1):9571. doi: 10.1038/s41467-026-76443-1. 10.1038/s41467-026-76443-1 PubMed 42706228
Related items: